Filtering lines
Filter lines from large text files
We’re going to switch away from find
, but we’re going to
stick with the general theme of using patterns. Another relatively
common task is to find lines within a plain text file that
match a certain pattern.
Depending on which courses you’re taking or have taken, this might be
a task where you would consider using a loop, but we’re going to take
advantage of a tool that’s available on the command line:
grep
.
What on earth does grep
mean?!
Computer Scientists and programmers are bad at naming things (maybe because it’s a “hard thing”). Maybe it is hard, but we’re still bad at naming things, and we should feel bad.
I’m digressing. The name grep
comes from a command in the
ed
editor that would “globally search
for a regular epression and
print matching lines”.
An unfortunate theme among useful programs in Unix and Unix-like operating systems (like Linux) is that their names aren’t discoverable.
Just finding the lines that match a pattern in a file can be useful,
but we’re going to look at a few options for grep
that can
help give some additional information or context about what we’re
looking for:
- Basic use: printing out matching lines.
- An option to count the number of matching lines.
- An option to show lines around the line we’re looking for.
- An option to search files recursively.
- An option to print the line number that matches the pattern.
Getting some data
Let’s start with a large text file.
The example we’re going to be using here is genetic sequence data. Similar to how Computer Scientists and programmers are bad at naming things, biologists and microbiologists are bad at storing things and they use plain text formats to store genetic sequence data. That’s actually really convenient for us because it gives a realistic data set to work with.
Don’t worry: you don’t need to be a biologist or microbiologist to follow along.
Download this file from NCBI to your user directory on
Aviary (use wget
or curl
):
https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/030/370/485/GCA_030370485.1_ASM3037048v1/GCA_030370485.1_ASM3037048v1_genomic.fna.gz
This file type is a gz
or “g-zipped” file (where the g
means gnu).
Once you’ve downloaded the file, you will have to decompress it!
gunzip gunzip GCA_030370485.1_ASM3037048v1_genomic.fna.gz
You should now see
GCA_030370485.1_ASM3037048v1_genomic.fna
, noting that the
.gz
is not at the end of the filename any more.
Now that it is unzipped - feel free to take a look at it using your
preferred text editor on Aviary (e.g., vim
,
nano
, emacs
). This is a FASTA-formatted
file. A FASTA-formatted file contains 1 or more “records”, where a
record will have a unique identifier that’s meaningful to a biologist or
microbiologist, and then the sequence data that corresponds to that
identifier. Records look like this:
>OR160415.1 Monkeypox virus isolate hMpxV/USA/IL-RIPHL-MPXV-050-0057/2023, complete genome
TTACAGATCATTTATATTCCAAAAATATTAACTATATACGTTTATTATATGATGTTAACGTGTAAATTATAAACATTATT
The file you just downloaded is about 200KB in size (there are about 200 thousand characters in this file), so doing things like counting records is not something we want to do by hand.
Basic use
You could do these exercises with any text file. Consider trying them with some of the markdown files you’ve created in the past, too!
Let’s start using grep
to filter and print out lines
that match a certain pattern.
From our crash course on FASTA-formatted files, we know that records
have unique identifiers, and the lines with unique identifiers contain
or start with the >
character. Let’s use that as our
filter:
grep '>' GCA_030370485.1_ASM3037048v1_genomic.fna # print all lines in the file that
# contain the > character
This will print out a bunch of lines (we’ll find out how many real
soon!), and all the lines contain the pattern >
.
We can actually be more precise with what we want by using an
“anchor” for our pattern. Records start with lines where the
first character on the line is >
. In
most FASTA-formatted files, the only place where the >
character appears is on the unique identifier line, but it’s possible
for it to appear in other places, too.
grep '^>' GCA_030370485.1_ASM3037048v1_genomic.fna # print all lines in the file that
# **start with** the > character
The ^
(caret, I prefer “hat”) is an “anchor”: “From the
start of the line”.
Counting lines
Seeing the lines that match the pattern is useful, but we may also
want to know other stuff, like how many lines matched the pattern.
Thankfully, grep
has an option to help us with that:
-c
.
grep -c '^>' GCA_030370485.1_ASM3037048v1_genomic.fna # count the lines in the file that
# start with the > character
This prints out only a number, and the number represents how many lines matched the pattern.
For GCA_030370485.1_ASM3037048v1_genomic.fna
, this tells
us how many records are in this file.
Showing lines around the matching lines
We can ask grep
to find lines that match patterns, and
we can also ask grep
to show us the lines that are around
(before and after) the line that matches the pattern. grep
calls this “context”.
We can print the lines that match the pattern, plus the lines
immediately after those using the -A
option (after):
grep -A 2 '^>' GCA_030370485.1_ASM3037048v1_genomic.fna # print out the record identifier and
# 2 lines of sequence data after it.
Similarly, we can print the lines that match the pattern, plus the
lines immediately before those using the -B
option
(before):
grep -B 2 '^>' GCA_030370485.1_ASM3037048v1_genomic.fna # print out the record identifier and
# 2 lines of sequence data before it.
We can do both at the same time with the -C
option (this
is upper-case C, for “context”):
grep -C 2 '^>' GCA_030370485.1_ASM3037048v1_genomic.fna # print out the record identifier and both
# 2 lines before and after it.
Filtering recursively
Sometimes you want to search many files in the same directory for a pattern, either because you don’t know which file contains the lines you’re looking for, or because your data is spread across many files.
We’ve seen a “recursive” command before in week 3:
rm -r hello # recursively remove hello and everything within it
The grep
command also has a recursive option, and it’s
also -r
!
Switch back to crazy-directories
. We were able to use
find
to help us find files that have names matching a
pattern. Now we want to use grep
to find files that contain
a specific pattern.
Emoji short codes all follow the same pattern: A colon, followed by some characters, followed by another colon. Here are some emoji and their short codes:
:banana:
🍌:robot:
🤖:sparkles:
✨
We can use grep
recursively to find all files that
contain one or more lines matching the pattern :*:
(a
colon, followed by any number of characters, followed by another
colon).
grep -r ":*:" # note no filename!
Depending on the state you’re in, this is probably going to print out
a few more files than you expected, including .docx
files.
Let’s talk about what .docx
files are: they’re secretly
a .zip
file. Remember how to unzip
.zip
files? That’s right! unzip
!
Go ahead, change into a directory containing one of the
.docx
files you created in crazy-directories
and unzip
it:
unzip robot.md.docx
There are going to be a bunch of new files in the directory that are
mostly .xml
files. XML is a “markup” language, sort of like
Markdown.
Try running grep
again recursively on this again and
you’ll see that we’re not just matching emoji short codes anymore, but a
bunch of weird looking XML. Neat 📷.
Printing matching line numbers
Knowing the name of the file containing the line that matches your
pattern is often enough, but grep
can help you out a little
more by telling you exactly the line number that matched the pattern.
You can ask grep
to tell you this using the -n
option.
If you left the root of crazy-directories
, change back
to it.
Let’s find all files that contain the pattern :*:
again,
but we’ll ask for grep
to print out the line numbers:
grep -rn ":*:"
# OR
grep -r -n ":*:"
Some command line tools will allow you to combine options
after a single -
(so -r -n
turns into
-rn
).